Illinois Data Bank

Next-gen sequencing and metadata analyses of Great Lakes fungal data

The data set consists of Illumina sequences derived from 48 sediment samples, collected in 2015 from Lake Michigan and Lake Superior for the purpose of inventorying the fungal diversity in these two lakes. DNA was extracted from ca. 0.5g of sediment using the MoBio PowerSoil DNA isolation kits following the Earth Microbiome protocol. PCR was completed with the fungal primers ITS1F and fITS7 using the Fluidigm Access Array. The resulting amplicons were sequenced using the Illumina Hi-Seq2500 platform with rapid 2 x 250nt paired-end reads. The enclosed data sets contain the forward read files for both primers, both fixed-header index files, and the associated map files needed to be processed in QIIME. In addition, enclosed are two rarefied OTU files used to evaluate fungal diversity. All decimal latitude and decimal longitude coordinates of our collecting sites are also included.

File descriptions:

Great_lakes_Map_coordinates.xlsx = coordinates of sample sites

QIIME Processing ITS1 region: These are the raw files used to process the ITS1 Illumina reads in QIIME. ***only forward reads were processed
GL_ITS1_HW_mapFile_meta.txt = This is the map file used in QIIME.
ITS1F_Miller_Fludigm_I1_fixedheader.fastq = Index file from Illumina. Headers were fixed to match the forward reads (R1) file in order to process in QIIME
ITS1F_Miller_Fludigm_R1.fastq = Forward Illumina reads for the ITS1 region.

QIIME Processing ITS2 region: These are the raw files used to process the ITS2 Illumina reads in QIIME. ***only forward reads were processed
GL_ITS2_HW_mapFile_meta.txt = This is the map file used in QIIME.
ITS7_Miller_Fludigm_I1_Fixedheaders.fastq = Index file from Illumina. Headers were fixed to match the forward reads (R1) file in order to process in QIIME
ITS7_Miller_Fludigm_R1.fastq = Forward Illumina reads for the ITS2 region.

Resulting OTU Table and OTU table with taxonomy
ITS1 Region
wahl_ITS1_R1_otu_table.csv = File contains Representative OTUs based on ITS1 region for all the R1 data and the number of each OTU found in each sample.
wahl_ITS1_R1_otu_table_w_tax.csv = File contains Representative OTUs based on ITS1 region for all the R1 and the number of each OTU found in each sample along with taxonomic determination based on the following database: sh_taxonomy_qiime_ver7_97_s_31.01.2016_dev

ITS2 Region
wahl_ITS2_R1_otu_table.csv = File contains Representative OTUs based on ITS2 region for all the R1 data and the number of each OTU found in each sample.
wahl_ITS2_R1_otu_table_w_tax.csv = File contains Representative OTUs based on ITS2 region for all the R1 data and the number of each OTU found in each sample along with taxonomic determination based on the following database: sh_taxonomy_qiime_ver7_97_s_31.01.2016_dev

Rarified illumina dataset for each ITS Region
ITS1_R1_nosing_rare_5000.csv = Environmental parameters and rarefied OTU dataset for ITS1 region.
ITS2_R1_nosing_rare_5000.csv = Environmental parameters and rarefied OTU dataset for ITS2 region.

Column headings:
#SampleID = code including researcher initials and sequential run number
BarcodeSequence =
LinkerPrimerSequence = two sequences used CTTGGTCATTTAGAGGAAGTAA or GTGARTCATCGAATCTTTG
ReversePrimer = two sequences used GCTGCGTTCTTCATCGATGC or TCCTCCGCTTATTGATATGC
run_prefix = initials of run operator
Sample = location code, see thesis figures 1 and 2 for mapped locations and Great_lakes_Map_coordinates.xlsx for exact coordinates.
DepthGroup = S= shallow (50-100 m), MS=mid-shallow (101-150 m), MD=mid-deep (151-200 m), and D=deep (>200 m)"
Depth_Meters = Depth in meters
Lake = lake name, Michigan or Superior
Nitrogen %
Carbon %
Date = mm/dd/yyyy
pH = acidity, potential of Hydrogen (pH) scale
SampleDescription = Sample or control
X = sequential run number
OTU ID = Operational taxonomic unit ID

Life Sciences
Illumina; next-generation sequencing; ITS; fungi
CC0
U.S. National Institutes of Health (NIH)-Grant:R01GM107490
Andrew N. Miller
3346 times
Version DOI Comment Publication Date
2 10.13012/B2IDB-9320144_V2 Some environmental measurements removed from dataset, data files added. 2018-03-01
1 10.13012/B2IDB-9320144_V1 2018-03-01

6.43 KB File
6.28 KB File
17.8 KB View File
1.22 GB File
9 GB File
58.1 KB File
45.9 KB File
1.35 GB File
9.92 GB File
57.8 KB File
114 KB File
52.3 KB File
99.5 KB File

Contact the Research Data Service for help interpreting this log.

Dataset update: {"all_globus"=>[nil, true]} 2026-01-16T15:38:22Z
Dataset update: {"all_medusa"=>[nil, true]} 2026-01-16T15:36:08Z
RelatedMaterial destroy: {"material_type"=>"Thesis", "availability"=>nil, "link"=>"http://hdl.handle.net/2142/97400", "uri"=>"", "uri_type"=>"Handle", "citation"=>"Wahl, Hannah E. 2017. What lies beneath? Fungal diversity at the bottom of the Great Lakes. M.S. Thesis, University of Illinois at Urbana-Champaign", "dataset_id"=>354, "selected_type"=>"Thesis", "datacite_list"=>"IsSupplementTo", "note"=>nil, "feature"=>nil} 2025-01-08T23:48:38Z
RelatedMaterial update: {"datacite_list"=>["IsSupplementTo,IsSupplementedBy ", "IsSupplementTo,IsSupplementedBy"]} 2024-04-18T18:23:35Z
RelatedMaterial create: {"material_type"=>"Code", "availability"=>nil, "link"=>"https://github.com/ebach/Great_Lake_Fungi/blob/master/Wahl_ITS1_OTUtable.R", "uri"=>"https://github.com/ebach/Great_Lake_Fungi/blob/master/Wahl_ITS1_OTUtable.R", "uri_type"=>"URL", "citation"=>"Code for sequence processing", "dataset_id"=>354, "selected_type"=>"Code", "datacite_list"=>"IsSupplementTo,IsSupplementedBy "} 2019-03-29T17:31:37Z
RelatedMaterial update: {"link"=>["", "https://doi.org/10.1016/j.jglr.2018.01.001"], "uri"=>["", "10.1016/j.jglr.2018.01.001"], "uri_type"=>["", "DOI"]} 2019-03-29T17:19:49Z
Dataset update: {"publication_state"=>["file embargo", "released"]} 2018-03-01T07:00:06Z
Dataset update: {"subject"=>[nil, "Life Sciences"]} 2018-02-09T16:19:18Z
Dataset update: {"version_comment"=>["Data files added", "Some environmental measurements removed from dataset, data files added."]} 2017-12-19T15:31:43Z
Dataset update: {"description"=>["The data set consists of Illumina sequences derived from 48 sediment samples, collected in 2015 from Lake Michigan and Lake Superior for the purpose of inventorying the fungal diversity in these two lakes. DNA was extracted from ca. 0.5g of sediment using the MoBio PowerSoil DNA isolation kits following the Earth Microbiome protocol. PCR was completed with the fungal primers ITS1F and fITS7 using the Fluidigm Access Array. The resulting amplicons were sequenced using the Illumina Hi-Seq2500 platform with rapid 2 x 250nt paired-end reads. The enclosed data sets contain the forward read files for both primers, both fixed-header index files, and the associated map files needed to be processed in QIIME. In addition, enclosed are two rarefied OTU files used to evaluate fungal diversity. All decimal latitude and decimal longitude coordinates of our collecting sites are also included.\r\n\r\nFile descriptions:\t\r\nQIIME Processing ITS1 region: These are the raw files used to process the ITS1 Illumina reads in QIIME. ***only forward reads were processed\r\nGL_ITS1_HW_mapFile_meta.txt \t= This is the map file used in QIIME. \r\nITS1F_Miller_Fludigm_I1_fixedheader.fastq = Index file from Illumina. Headers were fixed to match the forward reads (R1) file in order to process in QIIME\r\nITS1F_Miller_Fludigm_R1.fastq = Forward Illumina reads for the ITS1 region.\r\n\r\nQIIME Processing ITS2 region: These are the raw files used to process the ITS2 Illumina reads in QIIME. ***only forward reads were processed\r\nGL_ITS2_HW_mapFile_meta.txt\t= This is the map file used in QIIME. \r\nITS7_Miller_Fludigm_I1_Fixedheaders.fastq \t= Index file from Illumina. Headers were fixed to match the forward reads (R1) file in order to process in QIIME\r\nITS7_Miller_Fludigm_R1.fastq = Forward Illumina reads for the ITS2 region.\r\n\r\nResulting OTU Table and OTU table with taxonomy\r\nITS1 Region\r\nwahl_ITS1_R1_otu_table.csv = File contains Representative OTUs based on ITS1 region for all the R1 data and the number of each OTU found in each sample.\r\nwahl_ITS1_R1_otu_table_w_tax.csv = File contains Representative OTUs based on ITS1 region for all the R1 and the number of each OTU found in each sample along with taxonomic determination based on the following database: sh_taxonomy_qiime_ver7_97_s_31.01.2016_dev\r\n\r\nITS2 Region\r\nwahl_ITS2_R1_otu_table.csv = File contains Representative OTUs based on ITS2 region for all the R1 data and the number of each OTU found in each sample.\r\nwahl_ITS2_R1_otu_table_w_tax.csv = File contains Representative OTUs based on ITS2 region for all the R1 data and the number of each OTU found in each sample along with taxonomic determination based on the following database: sh_taxonomy_qiime_ver7_97_s_31.01.2016_dev\r\n\r\nRarified illumina dataset for each ITS Region \r\nITS1_R1_nosing_rare_5000.csv = Environmental parameters and rarefied OTU dataset for ITS1 region.\r\nITS2_R1_nosing_rare_5000.csv = Environmental parameters and rarefied OTU dataset for ITS2 region.\r\n\r\nOTU Tables containing only fungal associated OTUs as determined by NCBI, UNITE, and RDP classifier. \t\r\nwahl_ITS1_R1_otu_table.csv \r\nwahl_ITS1_R1_otu_table_w_tax.csv \r\nwahl_ITS2_R1_otu_table.csv\r\nwahl_ITS2_R1_otu_table_w_tax.csv\r\n\r\n\r\n\r\n\r\nGreat_lakes_Map_coordinates.xlsx = coordinates of sample sites \r\nITS1_R1_nosing_rare_5000.csv\t=\r\nITS2_R1_nosing_rare_5000.csv \t=\r\nITS7_Miller_Fludigm_R1.fastq =\r\nwahl_FINAL_filteredOTU_w_tax.csv =\r\nwahl_ITS1_R1_otu_table.csv =\r\nwahl_ITS1_R1_otu_table_w_tax.csv =\r\nwahl_ITS2_R1_otu_table.csv =\r\nwahl_ITS2_R1_otu_table_w_tax.csv =\r\n\r\nColumn headings:\r\n#SampleID\t = code including researcher initials and sequential run number\r\nBarcodeSequence = \r\nLinkerPrimerSequence = two sequences used CTTGGTCATTTAGAGGAAGTAA or GTGARTCATCGAATCTTTG \r\nReversePrimer = two sequences used GCTGCGTTCTTCATCGATGC or TCCTCCGCTTATTGATATGC\r\nrun_prefix = initials of run operator\r\nSample = location code, see thesis figures 1 and 2 for mapped locations and Great_lakes_Map_coordinates.xlsx for exact coordinates.\r\nDepthGroup = S= shallow (50-100 m), MS=mid-shallow (101-150 m), MD=mid-deep (151-200 m), and D=deep (>200 m)\" \r\nDepth_Meters = Depth in meters\r\nLake\t= lake name, Michigan or Superior\r\nNitrogen % \r\nCarbon % \r\nDate\t= mm/dd/yyyy\r\npH = acidity, potential of Hydrogen (pH) scale\r\nSampleDescription = Sample or control\r\nX = sequential run number\r\nOTU ID = Operational taxonomic unit ID ", "The data set consists of Illumina sequences derived from 48 sediment samples, collected in 2015 from Lake Michigan and Lake Superior for the purpose of inventorying the fungal diversity in these two lakes. DNA was extracted from ca. 0.5g of sediment using the MoBio PowerSoil DNA isolation kits following the Earth Microbiome protocol. PCR was completed with the fungal primers ITS1F and fITS7 using the Fluidigm Access Array. The resulting amplicons were sequenced using the Illumina Hi-Seq2500 platform with rapid 2 x 250nt paired-end reads. The enclosed data sets contain the forward read files for both primers, both fixed-header index files, and the associated map files needed to be processed in QIIME. In addition, enclosed are two rarefied OTU files used to evaluate fungal diversity. All decimal latitude and decimal longitude coordinates of our collecting sites are also included.\r\n\r\nFile descriptions:\t\r\n\r\nGreat_lakes_Map_coordinates.xlsx = coordinates of sample sites \r\n\r\nQIIME Processing ITS1 region: These are the raw files used to process the ITS1 Illumina reads in QIIME. ***only forward reads were processed\r\nGL_ITS1_HW_mapFile_meta.txt \t= This is the map file used in QIIME. \r\nITS1F_Miller_Fludigm_I1_fixedheader.fastq = Index file from Illumina. Headers were fixed to match the forward reads (R1) file in order to process in QIIME\r\nITS1F_Miller_Fludigm_R1.fastq = Forward Illumina reads for the ITS1 region.\r\n\r\nQIIME Processing ITS2 region: These are the raw files used to process the ITS2 Illumina reads in QIIME. ***only forward reads were processed\r\nGL_ITS2_HW_mapFile_meta.txt\t= This is the map file used in QIIME. \r\nITS7_Miller_Fludigm_I1_Fixedheaders.fastq \t= Index file from Illumina. Headers were fixed to match the forward reads (R1) file in order to process in QIIME\r\nITS7_Miller_Fludigm_R1.fastq = Forward Illumina reads for the ITS2 region.\r\n\r\nResulting OTU Table and OTU table with taxonomy\r\nITS1 Region\r\nwahl_ITS1_R1_otu_table.csv = File contains Representative OTUs based on ITS1 region for all the R1 data and the number of each OTU found in each sample.\r\nwahl_ITS1_R1_otu_table_w_tax.csv = File contains Representative OTUs based on ITS1 region for all the R1 and the number of each OTU found in each sample along with taxonomic determination based on the following database: sh_taxonomy_qiime_ver7_97_s_31.01.2016_dev\r\n\r\nITS2 Region\r\nwahl_ITS2_R1_otu_table.csv = File contains Representative OTUs based on ITS2 region for all the R1 data and the number of each OTU found in each sample.\r\nwahl_ITS2_R1_otu_table_w_tax.csv = File contains Representative OTUs based on ITS2 region for all the R1 data and the number of each OTU found in each sample along with taxonomic determination based on the following database: sh_taxonomy_qiime_ver7_97_s_31.01.2016_dev\r\n\r\nRarified illumina dataset for each ITS Region \r\nITS1_R1_nosing_rare_5000.csv = Environmental parameters and rarefied OTU dataset for ITS1 region.\r\nITS2_R1_nosing_rare_5000.csv = Environmental parameters and rarefied OTU dataset for ITS2 region.\r\n\r\nColumn headings:\r\n#SampleID\t = code including researcher initials and sequential run number\r\nBarcodeSequence = \r\nLinkerPrimerSequence = two sequences used CTTGGTCATTTAGAGGAAGTAA or GTGARTCATCGAATCTTTG \r\nReversePrimer = two sequences used GCTGCGTTCTTCATCGATGC or TCCTCCGCTTATTGATATGC\r\nrun_prefix = initials of run operator\r\nSample = location code, see thesis figures 1 and 2 for mapped locations and Great_lakes_Map_coordinates.xlsx for exact coordinates.\r\nDepthGroup = S= shallow (50-100 m), MS=mid-shallow (101-150 m), MD=mid-deep (151-200 m), and D=deep (>200 m)\" \r\nDepth_Meters = Depth in meters\r\nLake\t= lake name, Michigan or Superior\r\nNitrogen % \r\nCarbon % \r\nDate\t= mm/dd/yyyy\r\npH = acidity, potential of Hydrogen (pH) scale\r\nSampleDescription = Sample or control\r\nX = sequential run number\r\nOTU ID = Operational taxonomic unit ID "]} 2017-12-08T19:09:59Z
Dataset update: {"description"=>["The data set consists of Illumina sequences derived from 48 sediment samples, collected in 2015 from Lake Michigan and Lake Superior for the purpose of inventorying the fungal diversity in these two lakes. DNA was extracted from ca. 0.5g of sediment using the MoBio PowerSoil DNA isolation kits following the Earth Microbiome protocol. PCR was completed with the fungal primers ITS1F and fITS7 using the Fluidigm Access Array. The resulting amplicons were sequenced using the Illumina Hi-Seq2500 platform with rapid 2 x 250nt paired-end reads. The enclosed data sets contain the forward read files for both primers, both fixed-header index files, and the associated map files needed to be processed in QIIME. In addition, enclosed are two rarefied OTU files used to evaluate fungal diversity. All decimal latitude and decimal longitude coordinates of our collecting sites are also included.\r\n\r\nFile descriptions:\t\r\nGL_ITS1_HW_mapFile_meta.txt \t= \r\nGL_ITS2_HW_mapFile_meta.txt\t=\r\nGreat_lakes_Map_coordinates.xlsx = coordinates of sample sites \r\nITS1F_Miller_Fludigm_I1_fixedheader.fastq \t=\r\nITS1_R1_nosing_rare_5000.csv\t=\r\nITS2_R1_nosing_rare_5000.csv \t=\r\nITS7_Miller_Fludigm_I1_Fixedheaders.fastq \t=\r\nITS7_Miller_Fludigm_R1.fastq =\r\nwahl_FINAL_filteredOTU_w_tax.csv =\r\nwahl_ITS1_R1_otu_table.csv =\r\nwahl_ITS1_R1_otu_table_w_tax.csv =\r\nwahl_ITS2_R1_otu_table.csv =\r\nwahl_ITS2_R1_otu_table_w_tax.csv =\r\n\r\nColumn headings used:\r\n#SampleID\t = code including researcher initials and sequential run number\r\nBarcodeSequence = ?\r\nLinkerPrimerSequence = two sequences used CTTGGTCATTTAGAGGAAGTAA or GTGARTCATCGAATCTTTG \r\nReversePrimer = two sequences used GCTGCGTTCTTCATCGATGC or TCCTCCGCTTATTGATATGC\r\nrun_prefix = initials of run operator\r\nSample = location code, see thesis figures 1 and 2 for mapped locations and Great_lakes_Map_coordinates.xlsx for exact coordinates.\r\nDepthGroup = S= shallow (50-100 m), MS=mid-shallow (101-150 m), MD=mid-deep (151-200 m), and D=deep (>200 m)\" \r\nDepth_Meters = Depth in meters\r\nLake\t= lake name, Michigan or Superior\r\nNitrogen % =\r\nCarbon % =\r\nDate\t= mm/dd/yyyy\r\npH = acidity, potential of Hydrogen (pH) scale\r\nSampleDescription = Sample or control\r\nDescription = Person collecting/processing? sample\r\nreads = ?\r\nX = sequential run number\r\nOTU ID = Operational taxonomic unit ID (e.g., New.CleanUp.ReferenceOTU#, New.ReferenceOTU#) \r\ntaxonomy = blast matches, any taxonomic level\r\nphylum = blast matches at phylum level\r\nclass\t = blast matches at class level\r\norder\t= blast matches at order level\r\nfamily = blast matches at family level\r\ngenus.x = blast matches at genus level\r\nfinal = taxonomic designation based on blast hits at all levels", "The data set consists of Illumina sequences derived from 48 sediment samples, collected in 2015 from Lake Michigan and Lake Superior for the purpose of inventorying the fungal diversity in these two lakes. DNA was extracted from ca. 0.5g of sediment using the MoBio PowerSoil DNA isolation kits following the Earth Microbiome protocol. PCR was completed with the fungal primers ITS1F and fITS7 using the Fluidigm Access Array. The resulting amplicons were sequenced using the Illumina Hi-Seq2500 platform with rapid 2 x 250nt paired-end reads. The enclosed data sets contain the forward read files for both primers, both fixed-header index files, and the associated map files needed to be processed in QIIME. In addition, enclosed are two rarefied OTU files used to evaluate fungal diversity. All decimal latitude and decimal longitude coordinates of our collecting sites are also included.\r\n\r\nFile descriptions:\t\r\nQIIME Processing ITS1 region: These are the raw files used to process the ITS1 Illumina reads in QIIME. ***only forward reads were processed\r\nGL_ITS1_HW_mapFile_meta.txt \t= This is the map file used in QIIME. \r\nITS1F_Miller_Fludigm_I1_fixedheader.fastq = Index file from Illumina. Headers were fixed to match the forward reads (R1) file in order to process in QIIME\r\nITS1F_Miller_Fludigm_R1.fastq = Forward Illumina reads for the ITS1 region.\r\n\r\nQIIME Processing ITS2 region: These are the raw files used to process the ITS2 Illumina reads in QIIME. ***only forward reads were processed\r\nGL_ITS2_HW_mapFile_meta.txt\t= This is the map file used in QIIME. \r\nITS7_Miller_Fludigm_I1_Fixedheaders.fastq \t= Index file from Illumina. Headers were fixed to match the forward reads (R1) file in order to process in QIIME\r\nITS7_Miller_Fludigm_R1.fastq = Forward Illumina reads for the ITS2 region.\r\n\r\nResulting OTU Table and OTU table with taxonomy\r\nITS1 Region\r\nwahl_ITS1_R1_otu_table.csv = File contains Representative OTUs based on ITS1 region for all the R1 data and the number of each OTU found in each sample.\r\nwahl_ITS1_R1_otu_table_w_tax.csv = File contains Representative OTUs based on ITS1 region for all the R1 and the number of each OTU found in each sample along with taxonomic determination based on the following database: sh_taxonomy_qiime_ver7_97_s_31.01.2016_dev\r\n\r\nITS2 Region\r\nwahl_ITS2_R1_otu_table.csv = File contains Representative OTUs based on ITS2 region for all the R1 data and the number of each OTU found in each sample.\r\nwahl_ITS2_R1_otu_table_w_tax.csv = File contains Representative OTUs based on ITS2 region for all the R1 data and the number of each OTU found in each sample along with taxonomic determination based on the following database: sh_taxonomy_qiime_ver7_97_s_31.01.2016_dev\r\n\r\nRarified illumina dataset for each ITS Region \r\nITS1_R1_nosing_rare_5000.csv = Environmental parameters and rarefied OTU dataset for ITS1 region.\r\nITS2_R1_nosing_rare_5000.csv = Environmental parameters and rarefied OTU dataset for ITS2 region.\r\n\r\nOTU Tables containing only fungal associated OTUs as determined by NCBI, UNITE, and RDP classifier. \t\r\nwahl_ITS1_R1_otu_table.csv \r\nwahl_ITS1_R1_otu_table_w_tax.csv \r\nwahl_ITS2_R1_otu_table.csv\r\nwahl_ITS2_R1_otu_table_w_tax.csv\r\n\r\n\r\n\r\n\r\nGreat_lakes_Map_coordinates.xlsx = coordinates of sample sites \r\nITS1_R1_nosing_rare_5000.csv\t=\r\nITS2_R1_nosing_rare_5000.csv \t=\r\nITS7_Miller_Fludigm_R1.fastq =\r\nwahl_FINAL_filteredOTU_w_tax.csv =\r\nwahl_ITS1_R1_otu_table.csv =\r\nwahl_ITS1_R1_otu_table_w_tax.csv =\r\nwahl_ITS2_R1_otu_table.csv =\r\nwahl_ITS2_R1_otu_table_w_tax.csv =\r\n\r\nColumn headings:\r\n#SampleID\t = code including researcher initials and sequential run number\r\nBarcodeSequence = \r\nLinkerPrimerSequence = two sequences used CTTGGTCATTTAGAGGAAGTAA or GTGARTCATCGAATCTTTG \r\nReversePrimer = two sequences used GCTGCGTTCTTCATCGATGC or TCCTCCGCTTATTGATATGC\r\nrun_prefix = initials of run operator\r\nSample = location code, see thesis figures 1 and 2 for mapped locations and Great_lakes_Map_coordinates.xlsx for exact coordinates.\r\nDepthGroup = S= shallow (50-100 m), MS=mid-shallow (101-150 m), MD=mid-deep (151-200 m), and D=deep (>200 m)\" \r\nDepth_Meters = Depth in meters\r\nLake\t= lake name, Michigan or Superior\r\nNitrogen % \r\nCarbon % \r\nDate\t= mm/dd/yyyy\r\npH = acidity, potential of Hydrogen (pH) scale\r\nSampleDescription = Sample or control\r\nX = sequential run number\r\nOTU ID = Operational taxonomic unit ID "]} 2017-12-08T19:06:46Z
RelatedMaterial update: {"uri"=>["10.13012/B2IDB-9320144_V2", "10.13012/B2IDB-9320144_V1"]} 2017-12-06T18:29:53Z
RelatedMaterial update: {"uri"=>["", "10.13012/B2IDB-9320144_V2"]} 2017-12-06T18:28:15Z
Research Data Service Illinois Data Bank
Access and Use Policies Web Privacy Notice Contact Us